primer design program version 3.0 Search Results


95
Chem Impex International vwr extra pure
Vwr Extra Pure, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vwr extra pure/product/Chem Impex International
Average 95 stars, based on 1 article reviews
vwr extra pure - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

99
Psychology Software Tools e-prime
E Prime, supplied by Psychology Software Tools, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e-prime/product/Psychology Software Tools
Average 99 stars, based on 1 article reviews
e-prime - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

96
Bio-Rad master mix
Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/master mix/product/Bio-Rad
Average 96 stars, based on 1 article reviews
master mix - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

99
OriGene cggttagcagtatgttgtccagc 30 origene n a primers
Cggttagcagtatgttgtccagc 30 Origene N A Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cggttagcagtatgttgtccagc 30 origene n a primers/product/OriGene
Average 99 stars, based on 1 article reviews
cggttagcagtatgttgtccagc 30 origene n a primers - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

90
Promega primer s-30
Primer S 30, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer s-30/product/Promega
Average 90 stars, based on 1 article reviews
primer s-30 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
5 PRIME pchap3909
Pchap3909, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pchap3909/product/5 PRIME
Average 90 stars, based on 1 article reviews
pchap3909 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

98
Thermo Fisher antisense primer
Antisense Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antisense primer/product/Thermo Fisher
Average 98 stars, based on 1 article reviews
antisense primer - by Bioz Stars, 2026-05
98/100 stars
  Buy from Supplier

96
R&D Systems tgf β1
Tgf β1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tgf β1/product/R&D Systems
Average 96 stars, based on 1 article reviews
tgf β1 - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

90
GeneWorks tammar mt receptor-specific primer mtr 490
Tammar Mt Receptor Specific Primer Mtr 490, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tammar mt receptor-specific primer mtr 490/product/GeneWorks
Average 90 stars, based on 1 article reviews
tammar mt receptor-specific primer mtr 490 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

98
Bio-Rad reverse 50 agatttcactg tcgtcccacc 30 primers
Reverse 50 Agatttcactg Tcgtcccacc 30 Primers, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse 50 agatttcactg tcgtcccacc 30 primers/product/Bio-Rad
Average 98 stars, based on 1 article reviews
reverse 50 agatttcactg tcgtcccacc 30 primers - by Bioz Stars, 2026-05
98/100 stars
  Buy from Supplier

90
Primm srl oligonucleotide primers arcoi
Oligonucleotide Primers Arcoi, supplied by Primm srl, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligonucleotide primers arcoi/product/Primm srl
Average 90 stars, based on 1 article reviews
oligonucleotide primers arcoi - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Metabion International AG sox11 primers
Sox11 Primers, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sox11 primers/product/Metabion International AG
Average 90 stars, based on 1 article reviews
sox11 primers - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results