95
|
Chem Impex International
vwr extra pure Vwr Extra Pure, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/vwr extra pure/product/Chem Impex International Average 95 stars, based on 1 article reviews
vwr extra pure - by Bioz Stars,
2026-05
95/100 stars
|
Buy from Supplier |
99
|
Psychology Software Tools
e-prime E Prime, supplied by Psychology Software Tools, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/e-prime/product/Psychology Software Tools Average 99 stars, based on 1 article reviews
e-prime - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
96
|
Bio-Rad
master mix Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/master mix/product/Bio-Rad Average 96 stars, based on 1 article reviews
master mix - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
99
|
OriGene
cggttagcagtatgttgtccagc 30 origene n a primers Cggttagcagtatgttgtccagc 30 Origene N A Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cggttagcagtatgttgtccagc 30 origene n a primers/product/OriGene Average 99 stars, based on 1 article reviews
cggttagcagtatgttgtccagc 30 origene n a primers - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
90
|
Promega
primer s-30 Primer S 30, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer s-30/product/Promega Average 90 stars, based on 1 article reviews
primer s-30 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
5 PRIME
pchap3909 Pchap3909, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pchap3909/product/5 PRIME Average 90 stars, based on 1 article reviews
pchap3909 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
98
|
Thermo Fisher
antisense primer Antisense Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/antisense primer/product/Thermo Fisher Average 98 stars, based on 1 article reviews
antisense primer - by Bioz Stars,
2026-05
98/100 stars
|
Buy from Supplier |
96
|
R&D Systems
tgf β1 Tgf β1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tgf β1/product/R&D Systems Average 96 stars, based on 1 article reviews
tgf β1 - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
90
|
GeneWorks
tammar mt receptor-specific primer mtr 490 Tammar Mt Receptor Specific Primer Mtr 490, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tammar mt receptor-specific primer mtr 490/product/GeneWorks Average 90 stars, based on 1 article reviews
tammar mt receptor-specific primer mtr 490 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
98
|
Bio-Rad
reverse 50 agatttcactg tcgtcccacc 30 primers Reverse 50 Agatttcactg Tcgtcccacc 30 Primers, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse 50 agatttcactg tcgtcccacc 30 primers/product/Bio-Rad Average 98 stars, based on 1 article reviews
reverse 50 agatttcactg tcgtcccacc 30 primers - by Bioz Stars,
2026-05
98/100 stars
|
Buy from Supplier |
90
|
Primm srl
oligonucleotide primers arcoi Oligonucleotide Primers Arcoi, supplied by Primm srl, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oligonucleotide primers arcoi/product/Primm srl Average 90 stars, based on 1 article reviews
oligonucleotide primers arcoi - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
sox11 primers Sox11 Primers, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sox11 primers/product/Metabion International AG Average 90 stars, based on 1 article reviews
sox11 primers - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |